WebDharmaFECT® Duo is a lipid-based reagent specially formulated for co-transfection of plasmid and siRNA. Under optimized conditions, efficient delivery of both plasmid and siRNA can be achieved with minimal cell toxicity. As is generally observed with plasmid transfection, cell viability is reduced compared to siRNA transfection alone. WebThe siRNA was added to the DharmaFECT transfection reagent and incubated for 20 minutes at room temperature. Antibiotic-free complete medium (1,600 μL) was then added. Finally, the culture medium was removed from the wells of the six-well plates and 2 mL of the appropriate transfection medium was added to each well.

IJMS Free Full-Text Stearoyl-CoA Desaturase-1 Protects Cells ...

WebPepMute™ siRNA Transfection Reagent, formulated from simulation of virus cell penetrating peptides (CPPs), is a total novel siRNA delivery tool which provides more than 95% silencing efficiency at 1 nM siRNA in variety of mammalian cells. WebGuidelines GE Healthcare Dharmacon™ DharmaFECT™ Transfection Reagent Cell Type Guide Choose Dharmacon ™ DharmaFECT 1, 2, 3, or 4 for optimal transfection of … trump international hotel in vancouver

Order Dharmacon

WebLung cancer cells were transfected with USP14 siRNA (siUSP14#1 and siUSP14#2) or nonspecific siRNA (siNC) (all from Shanghai GenePharma Co., Ltd, China) using DharmaFECT one siRNA infection reagent (Thermo Fisher Scientific). The siRNA sequences were: siUSP14#1: GACAGAAAGUUAUGGUGAAAG; siUSP14#2: … WebScrambled siRNA (si-SCR) was obtained from Dharmacon (cat. no., #D-001210-01; GE Healthcare, Chicago, IL, USA). For transfection, 10 nM siRNA was mixed with DharmaFECT ® 1 transfection reagent (Dharmacon; GE Healthcare) and used according to the manufacturer's protocol. WebDharmaFECT 1 is our most all-purpose transfection reagent formulation; demonstrating efficient, low-toxicity delivery to over 35 cell types. DharmaFECT 1 achieves effective … philippine navy real estate office